| Basic information from miRBase |
| hairpin accession number: MI0012771 |
| Located between position 32583173 and 32583236 on chromosome 11 strand - |
| mature miRNAs for MI0012771: |
| eca-miR-142-5p (MIMAT0013022): CATAAAGTAGAAAGCACTACT |
| eca-miR-142-3p (MIMAT0013023): TGTAGTGTTTCCTACTTTATGGA |
| You can find this miRNA in ENTREZGENE: MIR142 (accession: 100315118) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |