| Basic information from miRBase |
| hairpin accession number: MI0012772 |
| Located between position 42750581 and 42750646 on chromosome 11 strand - |
| Overlapping with sense strand of FLOT2 (intron 10). |
| (Ensemble: ENSECAT00000012832) |
| mature miRNAs for MI0012772: |
| eca-miR-144 (MIMAT0013024): TACAGTATAGATGATGTACT |
| You can find this miRNA in ENTREZGENE: MIR144 (accession: 100315011) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |