| Basic information from miRBase |
| hairpin accession number: MI0012724 |
| Located between position 71148022 and 71148104 on chromosome 6 strand + |
| Overlapping with sense strand of LOC100064590 (intron 1). |
| (Ensemble: ENSECAT00000026506) |
| mature miRNAs for MI0012724: |
| eca-miR-148b-5p (MIMAT0012971): GAAGTTCTGTTATACACTCAGG |
| eca-miR-148b-3p (MIMAT0012972): TCAGTGCATCACAGAACTTTGT |
| You can find this miRNA in ENTREZGENE: MIR148B (accession: 100314816) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |