| Basic information from miRBase |
| hairpin accession number: MI0012725 |
| Located between position 25975930 and 25976018 on chromosome 6 strand + |
| Overlapping with sense strand of LOC100147336 (intron 2). |
| (Ensemble: ENSECAT00000014952) |
| mature miRNAs for MI0012725: |
| eca-miR-149 (MIMAT0012973): TCTGGCTCCGTGTCTTCACTCCC |
| You can find this miRNA in ENTREZGENE: MIR149 (accession: 100314817) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |