| Basic information from miRBase |
| hairpin accession number: MI0012690 |
| Located between position 107797720 and 107797786 on chromosome 4 strand - |
| Overlapping with sense strand of (intron 9). |
| (Ensemble: ENSECAT00000013292) |
| mature miRNAs for MI0012690: |
| eca-miR-153 (MIMAT0012936): TTGCATAGTCACAAAAGTGATC |
| You can find this miRNA in ENTREZGENE: MIR153 (accession: 100314798) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |