| Basic information from miRBase |
| hairpin accession number: MI0012691 |
| Located between position 84467059 and 84467133 on chromosome 4 strand - |
| Overlapping with antisense strand of LOC100056975 (intron 11). |
| (Ensemble: ENSECAT00000013635) |
| mature miRNAs for MI0012691: |
| eca-miR-182 (MIMAT0012937): TTTGGCAATGGTAGAACTCACACTG |
| You can find this miRNA in ENTREZGENE: MIR182 (accession: 100315003) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |