| Basic information from miRBase |
| hairpin accession number: MI0012937 |
| Located between position 10337925 and 10338009 on chromosome 30 strand - |
| Overlapping with antisense strand of IARS2 (intron 12). |
| (Ensemble: ENSECAT00000024407) |
| mature miRNAs for MI0012937: |
| eca-miR-194 (MIMAT0013050): TGTAACAGCAACTCCATGTGGA |
| You can find this miRNA in ENTREZGENE: MIR194-2 (accession: 100314930) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |