| Basic information from miRBase |
| hairpin accession number: MI0012922 |
| Located between position 31553692 and 31553760 on chromosome 25 strand - |
| Overlapping with antisense strand of DNM1 (intron 16). |
| (Ensemble: ENSECAT00000025260) |
| mature miRNAs for MI0012922: |
| eca-miR-199b-5p (MIMAT0013780): CCCAGTGTTTAGACTATCTGTTC |
| eca-miR-199b-3p (MIMAT0013781): ACAGTAGTCTGCACATTGGTTA |
| You can find this miRNA in ENTREZGENE: MIR199B (accession: 100314922) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |