| Basic information from miRBase |
| hairpin accession number: MI0012862 |
| Located between position 20137064 and 20137131 on chromosome 23 strand + |
| Overlapping with sense strand of TRPM3 (intron 6). |
| (Ensemble: ENSECAT00000009675) |
| mature miRNAs for MI0012862: |
| eca-miR-204b (MIMAT0013112): TTCCCTTTGTCATCCTATGCCT |
| You can find this miRNA in ENTREZGENE: MIR204B-2 (accession: 100315021) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |