| Basic information from miRBase |
| hairpin accession number: MI0012777 |
| Located between position 45640251 and 45640310 on chromosome 11 strand - |
| mature miRNAs for MI0012777: |
| eca-miR-212 (MIMAT0013030): TAACAGTCTCCAGTCACGGCC |
| You can find this miRNA in ENTREZGENE: MIR212 (accession: 100315103) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |