| Basic information from miRBase |
| hairpin accession number: MI0012683 |
| Located between position 103550490 and 103550551 on chromosome 3 strand - |
| Overlapping with sense strand of LOC100068338 (intron 11). |
| (Ensemble: ENSECAT00000024172) |
| mature miRNAs for MI0012683: |
| eca-miR-218 (MIMAT0012928): TTGTGCTTGATCTAACCATGT |
| You can find this miRNA in ENTREZGENE: MIR218 (accession: 100315041) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |