| Basic information from miRBase |
| hairpin accession number: MI0012738 |
| Located between position 44930163 and 44930230 on chromosome 7 strand + |
| Overlapping with antisense strand of (intron 5). |
| (Ensemble: ENSECAT00000009158) |
| mature miRNAs for MI0012738: |
| eca-miR-24 (MIMAT0012987): TGGCTCAGTTCAGCAGGAACAG |
| You can find this miRNA in ENTREZGENE: MIR24 (accession: 100315051) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |