| Basic information from miRBase |
| hairpin accession number: MI0012728 |
| Located between position 75354670 and 75354753 on chromosome 6 strand - |
| Overlapping with sense strand of LOC100053912 (intron 4). |
| (Ensemble: ENSECAT00000020049) |
| mature miRNAs for MI0012728: |
| eca-miR-26a (MIMAT0012975): TTCAAGTAATCCAGGATAGGCT |
| You can find this miRNA in ENTREZGENE: MIR26A (accession: 100314818) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |