| Basic information from miRBase |
| hairpin accession number: MI0012840 |
| Located between position 26408746 and 26408831 on chromosome 19 strand + |
| Overlapping with sense strand of LPP (intron 4). |
| (Ensemble: ENSECAT00000015392) |
| mature miRNAs for MI0012840: |
| eca-miR-28-5p (MIMAT0013092): AAGGAGCTCACAGTCTATTGAG |
| eca-miR-28-3p (MIMAT0013093): CACTAGATTGTGAGCTCCTGGA |
| You can find this miRNA in ENTREZGENE: MIR28 (accession: 100314878) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |