miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012668
Located between position 113629063 and 113629138 on chromosome 2 strand +
Overlapping with antisense strand of (intron 8).
(Ensemble: ENSECAT00000001915)
mature miRNAs for MI0012668:
         eca-miR-302b (MIMAT0012912): TAAGTGCTTCCATGTTTTAGTAG
You can find this miRNA in ENTREZGENE: MIR302B (accession: 100314786)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"