miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012924
Located between position 14424855 and 14424924 on chromosome 25 strand -
Overlapping with sense strand of LOC100059122 (intron 17).
(Ensemble: ENSECAT00000008409)
mature miRNAs for MI0012924:
         eca-miR-32 (MIMAT0013180): TATTGCACATTACTAAGTTGCA
You can find this miRNA in ENTREZGENE: MIR32 (accession: 100315086)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"