| Basic information from miRBase |
| hairpin accession number: MI0012935 |
| Located between position 38272567 and 38272635 on chromosome 28 strand + |
| Overlapping with sense strand of SREBF2 (intron 15). |
| (Ensemble: ENSECAT00000026599) |
| mature miRNAs for MI0012935: |
| eca-miR-33a (MIMAT0013189): GTGCATTGTAGTTGCATTGCA |
| You can find this miRNA in ENTREZGENE: MIR33A (accession: 100314929) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |