| Basic information from miRBase |
| hairpin accession number: MI0012741 |
| Located between position 20101138 and 20101221 on chromosome 7 strand + |
| mature miRNAs for MI0012741: |
| eca-miR-34b-5p (MIMAT0012990): AGGCAGTGTAATTAGCTGATTGT |
| eca-miR-34b-3p (MIMAT0012991): AATCACTAACTCCACTGCCATC |
| You can find this miRNA in ENTREZGENE: MIR34B (accession: 100314972) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |