| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001234 |
| Located between position 6302911 and 6303000 on chromosome 12 strand - |
| mature miRNAs for MI0001234: |
| gga-let-7a (MIMAT0001101): TGAGGTAGTAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: (accession: 777838) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| [3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" |
| more data |
| Data from CoGemiR |