| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001174 |
| Located between position 102425086 and 102425169 on chromosome 1 strand + |
| Overlapping with sense strand of (intron 7). |
| (Ensemble: ENSGALT00000030387) |
| mature miRNAs for MI0001174: |
| gga-let-7c (MIMAT0001104): TGAGGTAGTAGGTTGTATGGTT |
| You can find this miRNA in ENTREZGENE: (accession: 777928) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |