| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001233 |
| Located between position 6302497 and 6302583 on chromosome 12 strand - |
| mature miRNAs for MI0001233: |
| gga-let-7f (MIMAT0001162): TGAGGTAGTAGATTGTATAGTT |
| You can find this miRNA in ENTREZGENE: (accession: 777837) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |