| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001230 |
| Located between position 2809078 and 2809160 on chromosome 12 strand - |
| Overlapping with sense strand of WDR82_CHICK (intron 2). |
| (Ensemble: ENSGALT00000036280) |
| mature miRNAs for MI0001230: |
| gga-let-7g (MIMAT0001160): TGAGGTAGTAGTTTGTACAGT |
| You can find this miRNA in ENTREZGENE: (accession: 777834) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |