| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001263 |
| Located between position 1442897 and 1442979 on chromosome 26 strand - |
| mature miRNAs for MI0001263: |
| gga-let-7k (MIMAT0001182): TGAGGTAGTAGATTGAATAGTT |
| You can find this miRNA in ENTREZGENE: (accession: 777867) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |