| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001258 |
| Located between position 3372894 and 3372973 on chromosome 24 strand + |
| mature miRNAs for MI0001258: |
| gga-miR-100 (MIMAT0001178): AACCCGTAGATCCGAACTTGTG |
| You can find this miRNA in ENTREZGENE: (accession: 777862) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |