| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001270 |
| Located between position 28037874 and 28037952 on chromosome Z strand + |
| Overlapping with sense strand of RCL1 (intron 8). |
| (Ensemble: ENSGALT00000024230) |
| mature miRNAs for MI0001270: |
| gga-miR-101 (MIMAT0001185): GTACAGTACTGTGATAACTGAA |
| You can find this miRNA in ENTREZGENE: (accession: 777874) |
| References |
| [1]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| [2]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" |
| [3]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |
| more data |
| Data from CoGemiR |