| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001215 |
| Located between position 20487964 and 20488044 on chromosome 6 strand - |
| Overlapping with sense strand of PANK1 (intron 5). |
| (Ensemble: ENSGALT00000010382) |
| mature miRNAs for MI0001215: |
| gga-miR-107 (MIMAT0001147): AGCAGCATTGTACAGGGCTATCA |
| You can find this miRNA in ENTREZGENE: (accession: 777819) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |