| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001280 |
| Located between position 12066796 and 12066872 on chromosome Un_random strand - |
| mature miRNAs for MI0001280: |
| gga-miR-122 (MIMAT0001190): TGGAGTGTGACAATGGTGTTTGT |
| You can find this miRNA in ENTREZGENE: (accession: 777884) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]Xu H, Wang X, Du Z, Li N, FEBS Lett. 580:3610-3616(2006)., "Identification of microRNAs from different tissues of chicken embryo and adult chicken" |
| [3]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |