| Basic information from miRBase |
| hairpin accession number: MI0007547 |
| Located between position 60285286 and 60285362 on chromosome 4 strand - |
| Overlapping with sense strand of UNC5C_CHICK (intron 1). |
| (Ensemble: ENSGALT00000019955) |
| mature miRNAs for MI0007547: |
| gga-miR-122b (MIMAT0007719): AGTGTGACACTGGTGTTTTT |
| You can find this miRNA in ENTREZGENE: MIR122B (accession: 100315935) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |