| more data |
| Data from CoGemiR |
| Polymorphism data from Patrocles |
| Basic information from miRBase |
| hairpin accession number: MI0001197 |
| Located between position 118524157 and 118524252 on chromosome 2 strand + |
| mature miRNAs for MI0001197: |
| gga-miR-124a (MIMAT0001128): TTAAGGCACGCGGTGAATGCCA |
| You can find this miRNA in ENTREZGENE: (accession: 777801) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |
| more data |
| Data from CoGemiR |
| Polymorphism data from Patrocles |