| Basic information from miRBase |
| hairpin accession number: MI0008210 |
| Located between position 8681782 and 8681879 on chromosome 20 strand + |
| mature miRNAs for MI0008210: |
| gga-miR-124a (MIMAT0001128): TTAAGGCACGCGGTGAATGCCA |
| You can find this miRNA in ENTREZGENE: MIR124A-2 (accession: 100315938) |
| References |
| [1]Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH, Gene. 418:34-40(2008)., "Identification of novel chicken microRNAs and analysis of their genomic organization" |