| Basic information from miRBase |
| hairpin accession number: MI0001252 |
| Located between position 2510331 and 2510423 on chromosome 23 strand + |
| mature miRNAs for MI0001252: |
| gga-miR-124b (MIMAT0001174): TTAAGGCACGCAGTGAATGCCA |
| You can find this miRNA in ENTREZGENE: (accession: 777856) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |