Basic information from miRBase |
hairpin accession number: MI0001175 |
Located between position 102457647 and 102457736 on chromosome 1 strand + |
Overlapping with sense strand of (intron 7). |
(Ensemble: ENSGALT00000030387) |
mature miRNAs for MI0001175: |
gga-miR-125b (MIMAT0001105): TCCCTGAGACCCTAACTTGTGA |
You can find this miRNA in ENTREZGENE: (accession: 777929) |
References |
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
[2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
more data |
Data from CoGemiR |