| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001244 |
| Located between position 8431742 and 8431825 on chromosome 17 strand - |
| Overlapping with sense strand of EGFL7 (intron 7). |
| (Ensemble: ENSGALT00000003809) |
| mature miRNAs for MI0001244: |
| gga-miR-126* (MIMAT0003723): CATTATTACTTTTGGTACGCG |
| gga-miR-126 (MIMAT0001169): TCGTACCGTGAGTAATAATGCGC |
| You can find this miRNA in ENTREZGENE: (accession: 777848) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]Xu H, Wang X, Du Z, Li N, FEBS Lett. 580:3610-3616(2006)., "Identification of microRNAs from different tissues of chicken embryo and adult chicken" |
| [3]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |