| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001217 |
| Located between position 32228150 and 32228231 on chromosome 7 strand + |
| Overlapping with sense strand of R3HDM1 (intron 18). |
| (Ensemble: ENSGALT00000019996) |
| mature miRNAs for MI0001217: |
| gga-miR-128 (MIMAT0001123): TCACAGTGAACCGGTCTCTTT |
| You can find this miRNA in ENTREZGENE: (accession: 777821) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]Xu H, Wang X, Du Z, Li N, FEBS Lett. 580:3610-3616(2006)., "Identification of microRNAs from different tissues of chicken embryo and adult chicken" |
| [3]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |