Basic information from miRBase |
hairpin accession number: MI0001192 |
Located between position 45549176 and 45549259 on chromosome 2 strand + |
Overlapping with sense strand of LOC428459 (intron 16). |
(Ensemble: ENSGALT00000019676) |
mature miRNAs for MI0001192: |
gga-miR-128 (MIMAT0001123): TCACAGTGAACCGGTCTCTTT |
You can find this miRNA in ENTREZGENE: (accession: 777796) |
References |
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
[2]Xu H, Wang X, Du Z, Li N, FEBS Lett. 580:3610-3616(2006)., "Identification of microRNAs from different tissues of chicken embryo and adult chicken" |
[3]McBride D, Carre W, Law A, Clinton M, Unpublished., |
more data |
Data from CoGemiR |