| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001239 |
| Located between position 398720 and 398796 on chromosome 15 strand - |
| mature miRNAs for MI0001239: |
| gga-miR-130b (MIMAT0001165): CAGTGCAATAATGAAAGGGCGT |
| You can find this miRNA in ENTREZGENE: (accession: 777843) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |