| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001195 |
| Located between position 105670357 and 105670443 on chromosome 2 strand - |
| Overlapping with antisense strand of MIB1 (intron 12). |
| (Ensemble: ENSGALT00000024152) |
| mature miRNAs for MI0001195: |
| gga-miR-133a (MIMAT0001126): TTGGTCCCCTTCAACCAGCTGT |
| You can find this miRNA in ENTREZGENE: (accession: 777799) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |