Basic information from miRBase |
hairpin accession number: MI0001206 |
Located between position 110384933 and 110385016 on chromosome 3 strand - |
mature miRNAs for MI0001206: |
gga-miR-133b (MIMAT0001138): TTGGTCCCCTTCAACCAGCTA |
You can find this miRNA in ENTREZGENE: (accession: 777810) |
References |
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
more data |
Data from CoGemiR |
Polymorphism data from Patrocles |