miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001206
Located between position 110384933 and 110385016 on chromosome 3 strand -
mature miRNAs for MI0001206:
         gga-miR-133b (MIMAT0001138): TTGGTCCCCTTCAACCAGCTA
You can find this miRNA in ENTREZGENE: (accession: 777810)

References
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"


more data
Data from CoGemiR
Polymorphism data from Patrocles