| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001264 |
| Located between position 1925942 and 1926037 on chromosome 26 strand - |
| mature miRNAs for MI0001264: |
| gga-miR-135a (MIMAT0001099): TATGGCTTTTTATTCCTATGTGA |
| You can find this miRNA in ENTREZGENE: (accession: 777868) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |