| Basic information from miRBase |
| hairpin accession number: MI0015965 |
| Located between position 14731534 and 14731662 on chromosome Un_random strand + |
| mature miRNAs for MI0015965: |
| gga-miR-146c (MIMAT0007735): TGAGAACTGAATTCCATGGACTG |
| gga-miR-146c* (MIMAT0007736): AGTCCATGGTATTCAGTTCTCT |
| You can find this miRNA in ENTREZGENE: MIR146C (accession: 100316002) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |