| Basic information from miRBase |
| hairpin accession number: MI0007315 |
| Located between position 14876163 and 14876264 on chromosome 14 strand - |
| Overlapping with sense strand of LOC416752 (intron 2). |
| (Ensemble: ENSGALT00000014988) |
| mature miRNAs for MI0007315: |
| gga-miR-1588 (MIMAT0007450): CAGGAACCAGCTTTCGGCTCT |
| You can find this miRNA in ENTREZGENE: MIR1588 (accession: 100315728) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |