Basic information from miRBase |
hairpin accession number: MI0001185 |
Located between position 173700351 and 173700434 on chromosome 1 strand - |
mature miRNAs for MI0001185: |
gga-miR-16 (MIMAT0001116): TAGCAGCACGTAAATATTGGTG |
You can find this miRNA in ENTREZGENE: (accession: 777939) |
References |
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
[2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
[3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" |
more data |
Data from CoGemiR |
Polymorphism data from Patrocles |