miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001222
Located between position 23742791 and 23742884 on chromosome 9 strand -
Overlapping with sense strand of Q8AWB9_CHICK (intron 4).
(Ensemble: ENSGALT00000032997)
mature miRNAs for MI0001222:
         gga-miR-16 (MIMAT0001116): TAGCAGCACGTAAATATTGGTG
You can find this miRNA in ENTREZGENE: (accession: 777826)

References
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
[2]McBride D, Carre W, Law A, Clinton M, Unpublished.,
[3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"


more data
Data from CoGemiR