| Basic information from miRBase |
| hairpin accession number: MI0007328 |
| Located between position 2043673 and 2043749 on chromosome 24 strand + |
| Overlapping with sense strand of Q9DGI5_CHICK (intron 1). |
| (Ensemble: ENSGALT00000002187) |
| mature miRNAs for MI0007328: |
| gga-miR-1601 (MIMAT0007467): AGTGTGAGCAGGTGCAGAGCTG |
| You can find this miRNA in ENTREZGENE: MIR1601 (accession: 100315735) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |