| Basic information from miRBase |
| hairpin accession number: MI0007329 |
| Located between position 79189648 and 79189738 on chromosome 4 strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSGALT00000037306) |
| mature miRNAs for MI0007329: |
| gga-miR-1602 (MIMAT0007468): TGGGCTCTGCATCACCCCATGG |
| You can find this miRNA in ENTREZGENE: MIR1602 (accession: 100315941) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |