| Basic information from miRBase |
| hairpin accession number: MI0007332 |
| Located between position 64895966 and 64896053 on chromosome 4 strand - |
| mature miRNAs for MI0007332: |
| gga-miR-1605 (MIMAT0007471): AGGGTTTCATGTGTATCTCTTG |
| You can find this miRNA in ENTREZGENE: MIR1605 (accession: 100315737) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |