| Basic information from miRBase |
| hairpin accession number: MI0007334 |
| Located between position 45452355 and 45452433 on chromosome 2 strand + |
| mature miRNAs for MI0007334: |
| gga-miR-1607 (MIMAT0007473): AGGGGCGGGAGGGGTCGGGC |
| You can find this miRNA in ENTREZGENE: MIR1607 (accession: 100315738) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |