| Basic information from miRBase |
| hairpin accession number: MI0007337 |
| Located between position 17401478 and 17401571 on chromosome 13 strand + |
| Overlapping with sense strand of Q5W4T3_CHICK (intron 1). |
| (Ensemble: ENSGALT00000010935) |
| mature miRNAs for MI0007337: |
| gga-miR-1609 (MIMAT0007475): AGGCTGAGGCTGTGCTGGTTGT |
| You can find this miRNA in ENTREZGENE: MIR1609-2 (accession: 100315740) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |