| Basic information from miRBase |
| hairpin accession number: MI0007339 |
| Located between position 16350472 and 16350560 on chromosome 10 strand + |
| Overlapping with sense strand of CHD2 (intron 3). |
| (Ensemble: ENSGALT00000011260) |
| mature miRNAs for MI0007339: |
| gga-miR-1611 (MIMAT0007477): GGAGGGCTTGCAGGCGGTGTGC |
| You can find this miRNA in ENTREZGENE: MIR1611 (accession: 100315911) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |