| Basic information from miRBase |
| hairpin accession number: MI0007342 |
| Located between position 79850282 and 79850358 on chromosome 2 strand + |
| Overlapping with sense strand of CTNND2 (intron 3). |
| (Ensemble: ENSGALT00000037100) |
| mature miRNAs for MI0007342: |
| gga-miR-1613 (MIMAT0007479): TACATGCGTATATTCTGGCAG |
| You can find this miRNA in ENTREZGENE: MIR1613-2 (accession: 100315742) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |